JWD Subscribe to eTOC alerts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Journal of Wildlife Diseases, 43(4), 2007, pp. 668-674
© Wildlife Disease Association  2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faedo, M.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faedo, M.
Right arrow Articles by Rawlinson, W. D.

PREVALENCE OF MOUSE MAMMARY TUMOR VIRUS (MMTV) IN WILD HOUSE MICE (MUS MUSCULIS) IN SOUTHEASTERN AUSTRALIA

 Margaret Faedo1,2, Lyn A. Hinds3, Grant R. Singleton3,4 and William D. Rawlinson1,2,5

1 Virology Division, Department of Microbiology, South Eastern and Illawarra Arca Laboratory Services, The Prince of Wales Hospital, Barker St, Randwick, NSW 2031, Australia
2 School of Biochemistry and Biomedical Sciences, and the School of Medical Sciences, University of New South Wales, Sydney, NSW 2033, Australia
3 Commonweath Scientific and Industrial Research Organization Sustainable Ecosystems, Pest Animal Control Cooperative Research Centre, Canberra, ACT 2601, Australia
5 Corresponding author (email: w.rawlinson{at}unsw.edu.au)


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
ABSTRACT:   We determined the prevalence of mouse mammary tumor virus (MMTV) in introduced, free-roaming, wild house mice (Mus musculis) and compared envelope (env) and long terminal repeat (LTR) nucleotide sequences of viruses from wild mice and other sources. Mice were trapped on two occasions, in October (spring) and the following May (autumn) of 2003–2004 in the Mallee region of northwestern Victoria, Australia. Animals were assigned to three cohorts (subadult, young, and old adults) based on their body length. The DNA from salivary glands (62 of 62 mice) and mammary glands (19 of 32 female mice) was screened for the MMTV envelope (env) gene, and the long terminal repeat (LTR) region including the superantigen (SAg) sequence was amplified from a subset. Positive polymerase chain reaction (PCR) results for the MMTV env PCR were detected from salivary gland tissues from 60 of 62 (97%) mice and from mammary gland tissues from 19 of 19 (100%) female mice. All but two mice were positive for MMTV env across both sexes and the three cohorts. Similarity of the SAg carboxy-terminal nucleotide sequence between free-roaming wild house mice varied from 64% to 99%, although most of this variation was due to DNA sequences from two mice (M4 and M5). Phylogenetic analysis of the LTR region did not result in distinct grouping of sequences derived from mice when comparisons were made among sequences from mice in the US, Europe, and Australia, and MMTV-like virus (MMTV-LV) env sequences derived from human hosts. We report a high prevalence of the MMTV env sequence during a sampling period when peak mouse density was low. This indicates that MMTV is an enzootic virus in a population of wild, free-ranging mice in northwestern Victoria, in Australia. Phylogenetic analysis, based upon env and LTR sequence data, indicated minor variation among all isolates. This represents the first report on the prevalence of MMTV in mouse populations in Australia.
  Key words:  Australia, long terminal repeat, LTR, MMTV, mouse mammary tumor virus, Mus musculis PCR, wild house mice.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In Australia and elsewhere, populations of the introduced house mouse (Mus musculis) can increase to very high numbers. Widespread population increases (mouse plagues) of house mice occur at irregular intervals in Australia (Singleton et al., 2005). Mice in wild and domestic habitats are infected with a range of viral pathogens, including mouse mammary tumor virus (MMTV), and we postulated that this virus was present in wild house mice in Australia.

Mouse mammary tumor virus is a non-transforming retrovirus that causes breast cancer in mice via insertion of a provirus near a known set of protooncogenes, resulting in upregulation of these genes and tumorigenesis (Cohen, 1979; Nusse and Varmus, 1982; Callahan and Smith, 2000). We and others have also identified MMTV-like envelope (env) sequences in another species (humans) from Australia and the US (Wang et al., 2001; Ford et al., 2003; Etkind et al., 2004; Faedo et al., 2004). Currently, there is no published information on the prevalence of MMTV in free-roaming wild house mice in Australia. Our objective was to investigate the prevalence of MMTV in wild-caught house mice sampled from the same location (northwestern Victoria, Australia) in spring and again the following autumn in order to determine prevalence rates. Moreover, we compared the DNA sequences obtained from these free-roaming wild house mice with those from other continents and MMTV-like sequences from humans. This is preliminary to examining the potential for zoonotic transmission of MMTV from mice to humans.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 LITERATURE CITED
 
Trapping was conducted on two occasions, in October 2003 (spring) and the following May 2004 (autumn), in wheat fields at Walpeup (35°08'S, 142°02'E), northwestern Victoria, Australia. Traps were set in the afternoon and evening and checked soon after sunrise. Each mouse was killed by cervical dislocation, weighed, sexed, and measured for length, and their breeding condition was assessed (females—pregnant, lactating, uterine scars; males—scrotal or abdominal testes). Animals were assigned to three cohorts based on their body length: subadults were <72 mm, young adults were 72 to 77 mm, and old adults were >78 mm (Singleton, 1989). Appropriate organs (mammary glands and salivary glands) were removed from all mice aseptically and immediately placed into uniquely numbered vials that were then stored in liquid nitrogen.

Standard precautions were followed to avoid contamination, including separate rooms for polymerase chain reaction (PCR) preparation, DNA extraction, and DNA amplification. DNA was extracted from tissues using a QIAamp DNA mini kit (cat. no. 51306, Qiagen, Doncaster, Australia), according to the manufacturer’s protocol. All samples were screened first for a housekeeping gene (GAPDH), and, if positive, they were then tested for MMTV envelope (env) as described in Ford et al. (2003). In brief, RNA was reverse transcribed with poly (dT) primer, cDNA was subjected to 35 rounds of amplification using primer MMTV1F (sequence CCAGATCGCCTTTAAGAAG, at position 695–714 on MMTV sequence, with Genbank accession number AF43689) with MMTV2R (sequence TACAGGTAGCAGCACTATGG, at position 1269–1289 on MMTV sequence, accession number AF43689). A second set of reactions was performed with primer MMTV3F (sequence TGCGCCTTCCCTGACCAGGG, located at position 762–781 on MMTV sequence, with Genbank accession number AF43689) with MMTV4R (sequence GTAACACAGGCAGATGTAGG, at position 1048–1117 on MMTV sequence, accession number AF43689). The amplified DNA was detected using gel electrophoresis on 1% agarose gels (Ford et al., 2003; Faedo et al., 2004).

The long terminal repeat (LTR) region of MMTV was amplified (Wang et al., 2001), and sequences were compared to published sequences from mice positive for exogenous and endogenous MMTV (Donehower et al., 1983; King et al., 1990; Korman et al., 1992; Pullen et al., 1992; Rudy et al., 1992) and published sequences from another (human) host (Liu et al., 2001; Wang et al., 2001; Ford et al., 2003; Etkind et al., 2004; Faedo et al., 2004). Nucleic acid sequences were aligned using Clustal W, and a tree was constructed from the carboxy-terminal superantigen (SAg) sequences contained within the amplified LTR region using DNApars (ANGIS, 2005; Felsenstein, 1989). This program was used to perform unrooted parsimony analysis, analogous to construction of Wagner trees (Eck and Dayhoff, 1966; Kluge and Farris, 1969).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 LITERATURE CITED
 
Only nine adult female mice were collected early in the breeding season in October 2003. Of these, eight were pregnant and lactating, and one was lactating. No adult males were collected for analysis at this time. In May 2004, 23 females and 30 males were sampled. The May sample was evenly distributed across the three age cohorts of mice for both sexes. Of the 17 adult females, three were pregnant, and eight were lactating. All but two mice were positive for MMTV across both sexes and the three cohorts (Tables 1Go and 2Go). These positives represent endogenous MMTV, exogenous MMTV, or both, since both would contain the env gene amplified by PCR. A segment of the open reading frame coding for the MMTV SAg was amplified from salivary gland tissue of 28 mice (20 males and eight females) positive for MMTV env. The identity of the SAg carboxy-terminal DNA sequence between the wild house mice varied between 64% and 99% (Liu et al., 2001; Ford et al., 2003; Etkind et al., 2004; Faedo et al., 2004). Most of this variation was due to DNA sequences from two mice (M4 and M5). Variation in SAg between mice was 93% to 97% when these two sequences were removed. Four of the 11 published mouse sequences were from strain DBA/2J (an inbred strain with no outlying wildness measurements), and these were 98% to 99% identical in nucleotide sequence in the SAg carboxy-terminal region. When a DNA sequence from DBA/2J was included in the comparison, the five sequences were 64–99% similar. Three DNA sequences were from the strain C3H, and these varied by 71% to 99% from the consensus, but on removing one endogenous isolate, the remaining two exogenous isolates were 99 % similar. Overall the 11 published mice DNA sequences varied in SAg nucleotide sequence by 64% to 99%.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Prevalence of the mouse mammary tumor virus (MMTV) in salivary and mammary glands of wild house mice (Mus musculis). Mice were sampled in spring and autumn 2003–2004 at Walpeup, northwestern Victoria, Australia.

 

View this table:
[in this window]
[in a new window]

  		TABLE 2. Prevalence of mouse mammary tumor virus (MMTV) tabulated for season, sex, tissue, and cohort size in free-roaming wild house mice (Mus musculis). Mice were sampled in spring and autumn 2003–2004 at Walpeup, northwestern Victoria, Australia.

 
The sequences derived from free-roaming wild house mice in Australia did not form a distinct group from those derived from mice in Europe, the US, or those derived from humans. The alignment of published mouse sequences showed that they did not appear to group according to endogenous or exogenous origin, but rather nucleotide sequences obtained from particular strains of mice grouped together. Notably, Mtv-6.1, Mtv-6.2, Mtv-1, and Mtv-13 were all derived from the DBA/2 strain. Likewise, Australian mouse sequences grouped with both endogenous and exogenous sequences. There was no clustering of Australian isolates, and both Australian wild house mouse (Figs. 1Go, 2Go) and human sequences were distributed throughout groups (Figs. 1Go, 2Go).


Figure 1
View larger version (154K):
[in this window]
[in a new window]

  		FIGURE 1. Derived protein sequence of the carboxy-terminal end of the mouse mammary tumor virus (MMTV) superantigen from Australian wild house mice aligned with: (A) derived protein sequences from published mice sequences and (B) derived protein sequences from human MMTV-like virus (MMTV-LV) sequences in human breast cancers. Australian wild house mouse sequences: M1—0504002, 0504008, 0504029, 0504034, 0504035, 0504042, 0504044, and 310003; M2—0504011, 0504012, 0504037, 0504049, 0504051, 310002, 310010, and 310014; M3—0504001, 0504006, and 0504045; M4—0504004; M5—0504007; M6—0504010; M7—0504023; M8—0504025; M9—0504026; M10—310005; M11—310008; M12—310009. Published mice sequences: Mtv-1, (DBA/2), X63024 (Pullen et al., 1992) and X64553 (Korman et al., 1992); Mtv-6.1, DBA/2, X63026 (Pullen et al., 1992); Mtv-6.2, DBA/2, X64554 (Korman et al., 1992); Mtv-8, C3H, J02273 (Donehower et al., 1983); Mtv-9, B10.A, M29600 (King et al., 1990); Mtv-13, DBA/2, X63027 (Pullen et al., 1992) and X64555 (Korman et al., 1992); Mtv-17, DBA/2J, X64556 (Korman et al., 1992); Mtv-43, MA/MyJ, X64541 (Rudy et al., 1992); C3H.1, J02274, (Donehower et al., 1983); C3H.2, K00556 (Majors and Varmus, 1983) and SW-21, X65340 (Held et al., 1992). Australian human breast cancers: B12—infiltrating ductal carcinoma (IDC) grade I; B32—IDC grade II; B33—IDC grade II and B39, IDC grade I. Published human breast cancers: Pub1—AY652968 (Etkind et al., 2004) and AF243039 (Liu et al., 2001); Pub2—AY652967 and AY652969 (Etkind et al., 2004); Pub3—AY652964 (Etkind et al., 2004); Pub4—AY652973 (Etkind et al., 2004); Pub5—AY652974 (Etkind et al., 2004); Pub6—AY652977 (Etkind et al., 2004). Note, M11, position 71, had a double peak in the DNA sequence, which results in either arginine or serine, indicated in the alignment by ?. A stop codon is indicated by *.

 

Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 2. Cluster analysis of the derived protein sequence of the carboxy-terminal end of the mouse mammary tumor virus (MMTV) superantigen from Australian wild house mice, including a subset of derived protein sequences from published mouse and human MMTV-like virus (MMTV-LV) sequences in human breast cancers from data in Figure 1Go.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
LITERATURE CITED
 
Evidence of MMTV was found in nearly all male and all female mice sampled. Comparison of different MMTV genomes was based upon sequencing the envelope gene (env) and the long terminal repeat (LTR) regions. The env gene encodes a surface protein subject to host immune selective pressure, and the LTR encodes a superantigen (SAg) under different selective pressure. Despite the difference in the proteins encoded by these two genes, with the exception of two mice, MMTV was fairly homogeneous in env and LTR nucleotide, and derived amino acid sequences.

There is little published information on the prevalence of MMTV in wild house mice, and the majority of investigations have focussed on MMTV in laboratory strains (Callahan et al., 1982, 1986). In this study, we report a high prevalence of MMTV based on detection of the env and LTR sequences in subadult and adult male and female house mice. House mice in wheat fields in this region can have a breeding season as short as 4.5 mo or as long as 10 mo, and peak annual population densities vary from less than one mouse per hectare to more than 1,000 mice per hectare (Singleton et al., 2005). In 2003, peak mouse density was low (<30 mice per hectare; P. Brown and A. Arthur, unpubl. data), and the breeding season lasted 7.5 mo. Under these population conditions, the prevalence of the virus in all samples of mammary and salivary glands of females and in a majority of subadult, young adult, and old adult animals of both sexes indicates that MMTV is an enzootic virus in this population of free-roaming, wild house mice in Victoria, Australia.

Two studies performed in California (USA), used electron microscopy (EM) to detect type B particles in wild caught house mice (Rongey et al., 1973, 1975). The first found that 60% of female mice (25 of 43) were positive for type B particles (thought to represent MMTV) in breast tissue (Rongey et al., 1973). Similar results were noted in 58% (seven of 12) of milk samples, although no type B particles were detected in spleen samples (0 of 35) (Rongey et al., 1973). The second study collected the submaxillary gland of males and females, and it detected type B particles in only 22% (six of 27) of pregnant females (Rongey et al., 1975), and type B particles were not seen in nonpregnant females (zero of seven) or normal males (zero of 14; Rongey et al., 1975). The proportion of positive mice found in both studies is considerably lower than that found in this study. This could be expected since the previous analyses depended on the virus being expressed in the tissues at the time of sampling, and they utilized EM, where we tested using PCR in two tissues. Some of the mice previously studied may have been positive for virus DNA but not producing viral particles (Rongey et al., 1973, 1975).

Screening by PCR will detect provirus or free whole virus particles, and hence both endogenous and exogenous MMTV will be found using the methods described here. The carboxy-terminal region of the SAg of MMTV is polymorphic, and some authors have suggested that it can be used to distinguish isolates of endogenous and exogenous origin (Brandt-Carlson et al., 1993). It is not possible to determine if the positives detected in our studies represent active viral infection or endogenous MMTV. It is not clear from published studies if endogenous MMTV is capable of producing retroviral-type particles. Studies from groups in the US and Australia indicate that MMTV SAg and env-like gene products are present in humans (Wang et al., 2001; Ford et al., 2003; Etkind et al., 2004; Faedo et al., 2004). The alignments of env and LTR sequences performed here indicate little variation between nucleotide and derived amino acid sequences from MMTV of mice and MMTV-LV of humans (Figs. 1Go, 2Go). Another area of investigation involves determining if wild animal contacts of mice also have MMTV sequences, particularly given that MMTV causes tumors and death of mice (Stewart et al., 2000).

This study indicates for the first time, that MMTV is prevalent in wild-caught house mice in an agricultural area in southern Australia. It is unknown if a similar prevalence occurs in metropolitan regions, and further research to address prevalence of MMTV in urban house mice, and other species contacting (or feeding upon) mice, is required. Epidemiological surveys of the animal host are important because they define the virology of the wild population. We have shown similarities between derived amino acid sequences of MMTV env derived from MMTV populations around the world and MMTV-LV of humans. Although there are currently no data on MMTV-LV in humans as a zoonotic infection, this genetic similarity between MMTV and human MMTV-LV should stimulate further study of this area.


   ACKNOWLEDGMENTS
 
The authors would like to thank D. Jones and M. Davies for collecting the mice, dissecting the tissues, and dispatching the samples to Sydney.


   FOOTNOTES
 
4 Current address: International Rice Research Institute, DAPO, Box 7777, Metro Manile, Phillipines Back


   LITERATURE CITED
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
ANGIS. 2005. Biomanager, Vol. 2005, http://www.angis.org.au. Accessed December 2005.

BRANDT-CARLSON, C., J. S. BUTEL, AND D. WHEELER. 1993. Phylogenetic and structural analyses of MMTV LTR ORF sequences of exogenous and endogenous origins. Virology 193: 171–185.[Medline]

CALLAHAN, R., AND G. H. SMITH. 2000. MMTV-induced mammary tumorigenesis: Gene discovery, progression to malignancy and cellular pathways. Oncogene 19: 992–1001.[Medline]

———, W. DROHAN, D. GALLAHAN, L. D’HOOSTELAERE, AND M. POTTER. 1982. Novel class of mouse mammary tumor virus–related DNA sequences found in all species of Mus, including mice lacking the virus proviral genome. Proceedings of the National Academy of Sciences of the United States of America 79: 4113–4117.[Abstract/Free Full Text]

———, D. GALLAHAN, L. A. D’HOOSTELAERE, AND M. POTTER. 1986. Endogenous MMTV proviral genomes in feral Mus musculus domesticus. Current Topics in Microbiology & Immunology 127: 362–370.

COHEN, J. C., P. R. SHANK, V. L. MORRIS, R. CARDIFF, AND H. E. VARMUS. 1979. Integration of the DNA of mouse mammary tumor virus in virus-infected normal and neoplastic tissue of the mouse. Cell 16 (2): 333–345.[Medline]

DONEHOWER, L. A., B. FLEURDELYS, AND G. L. HAGER. 1983. Further evidence for the protein coding potential of the mouse mammary tumor virus long terminal repeat: Nucleotide sequence of an endogenous proviral long terminal repeat. Journal of Virology 45: 941–949.[Abstract/Free Full Text]

ECK, R. V., AND M. O. DAYHOFF. 1966. Atlas of protein sequence and structure 1966. National Biomedical Research Foundation, Silver Spring, Maryland, pp. 1–215.

ETKIND, P. R., A. F. STEWART, T. DORAI, D. J. PURCELL, AND P. H. WIERNIK. 2004. Clonal isolation of different strains of mouse mammary tumor virus–like DNA sequences from both the breast tumors and non-Hodgkin’s lymphomas of individual patients diagnosed with both malignancies. Clinical Cancer Research 10: 5656–5664.[Abstract/Free Full Text]

FAEDO, M., C. E. FORD, R. MEHTA, K. BLAZEK, AND W. D. RAWLINSON. 2004. Mouse mammary tumor–like virus is associated with p53 nuclear accumulation and progesterone receptor positivity but not estrogen positivity in human female breast cancer. Clinical Cancer Research 10: 4417–4419.[Abstract/Free Full Text]

FELSENSTEIN, J. 1988. Phylogenies from molecular sequences. Annual review of genetics 22: 521–565.[Medline]

FORD, C. E., D. TRAN, Y. DENG, V. T. TA, W. D. RAWLINSON, AND J. S. LAWSON. 2003. MMTV-like gene sequences in breast tumours of Australian and Vietnamese women. Clinical Cancer Research 9: 1118–1120.[Abstract/Free Full Text]

HELD, W., A. N. SHAKHOV, G. WAANDERS, L. SCARPELLINO, R. LUETHY, J. P. KRAEHENBUHL, H. R. MACDONALD, AND H. ACHA-ORBEA. 1992. An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7). Journal of Experimental Medicine 175: 1623–1633.[Abstract/Free Full Text]

KING, L. B., F. E. LUND, D. A. WHITE, S. SHARMA, AND R. B. CORLEY. 1990. Molecular events in B lymphocyte differentiation. Inducible expression of the endogenous mouse mammary tumor proviral gene, Mtv-9. Journal of Immunology 144: 3218–3227.[Abstract]

KLUGE, A. G., AND J. S. FARRIS. 1969. Quantitative phyletics and the evolution of anurans. Systematic Zoology 18: 1–32.

KORMAN, A. J., P. BOURGAREL, T. MEO, AND G. E. RIECKHOF. 1992. The mouse mammary tumour virus long terminal repeat encodes a type II transmembrane glycoprotein. The EMBO (European Molecular Biology Organisation) Journal 11: 1901–1905.

LIU, B., Y. WANG, S. M. MELANA, I. PELISSON, V. NAJFELD, J. F. HOLLAND, AND B. G.-T. POGO. 2001. Identification of a proviral structure in human breast cancer. Cancer Research 61: 1754–1759.[Abstract/Free Full Text]

MAJORS, J. E., AND H. E. VARMUS. 1983. Nucleotide sequencing of an apparent proviral copy of env mRNA defines determinants of expression of the mouse mammary tumor virus env gene. Journal of Virology 47: 495–504.[Abstract/Free Full Text]

NUSSE, R., AND H. E. VARMUS. 1982. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31 (1): 99–109.[Medline]

PULLEN, A. M., Y. CHOI, E. KUSHNIR, J. KAPPLER, AND P. MARRACK. 1992. The open reading frames in the 3' long terminal repeats of several mouse mammary tumor virus integrants encode V beta 3-specific superantigens. Journal of Experimental Medicine 175: 41–47.[Abstract/Free Full Text]

RONGEY, R. W., A. HLAVACKOVA, S. LARA, J. ESTES, AND M. B. GARDNER. 1973. Types B and C RNA virus in breast tissue and milk of wild mice. Journal of the National Cancer Institute 50: 1581–1589.[Medline]

———, A. H. ABTIN, J. D. ESTES, AND M. B. GARDNER. 1975. Mammary tumor virus particles in the submaxillary gland, seminal vesicle, and nonmammary tumors of wild mice. Journal of the National Cancer Institute 54: 1149–1156.[Medline]

RUDY, C. K., E. KRAUS, E. PALMER, AND B. T. HUBER. 1992. Mls-1-like superantigen in the MA/MyJ mouse is encoded by a new mammary tumor provirus that is distinct from Mtv-7. Journal of Experimental Medicine 175: 1613–1621.[Abstract/Free Full Text]

SINGLETON, G. R. 1989. Population dynamics of an outbreak of house mice (Mus domesticus) in the Mallee wheatlands of Australia—Hypothesis of plague formation. Journal of Zoology (London) 219: 495–515.

———, BROWN, P. R., R. P. PECH, J. JACOB, G. J. MUTZE, AND C. J. KREBS. 2005. One hundred years of eruptions of house mice in Australia—A natural biological curio. Biological Journal of the Linnean Society 84: 617–627.

STEWART, T. H., R. D. SAGE, A. F. STEWART, AND D. W. CAMERON. 2000. Breast cancer incidence highest in the range of one species of house mouse, Mus domesticus. British Journal of Cancer 82: 446–451.[Medline]

WANG, Y., I. PELISSON, S. M. MELANA, J. F. HOLLAND, AND B. G.-T. POGO. 2001. Detection of MMTV-like LTR and LTR-env gene sequences in human breast cancer. International Journal of Oncology 18: 1041–1044.[Medline]

Received for publication 16 June 2005.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faedo, M.
Right arrow Articles by Rawlinson, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faedo, M.
Right arrow Articles by Rawlinson, W. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS