JWD
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Journal of Wildlife Diseases, 42(2), 2006, pp. 359-365
© Wildlife Disease Association  2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moks, E.
Right arrow Articles by Valdmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moks, E.
Right arrow Articles by Valdmann, H.

HELMINTHOLOGIC SURVEY OF THE WOLF (CANIS LUPUS) IN ESTONIA, WITH AN EMPHASIS ON ECHINOCOCCUS GRANULOSUS

E. Moks1,4, I. Jõgisalu1,4, U. Saarma1,2,4, H. Talvik3, T. Järvis3 and H. Valdmann1,4,5

1 Department of Integrative Zoology, University of Tartu, Vanemuise 46, 51014, Tartu, Estonia
2 Estonian Biocentre, Riia 23, 51010 Tartu, Estonia
3 Department of Infectious Diseases, Estonian Agricultural University, Kreutzwaldi 62, 51014, Tartu, Estonia
5 Corresponding author (email: Harri.Valdmann{at}ut.ee)


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
ABSTRACT:   Carcasses of 26 wolves were collected during the 2000/2001 and 2003/2004 hunting seasons and examined for helminths. Thirteen helminth species were recorded: one trematode (Alaria alata), seven cestodes (Diphyllobothrium latum, Mesocestoides lineatus, Taenia hydatigena, Taenia multiceps, Taenia ovis, Taenia pisiformis, and Echinococcus granulosus), and five nematode species (Uncinaria stenocephala, Toxascaris leonina, Toxocara canis, Trichinella nativa, and Trichinella britovi). The most common species were A. alata and U. stenocephala. Mature Echinococcus granulosus was found and described for the first time in Estonia, and its identity verified using PCR-RFLP analysis. Sequencing a fragment of the mitochondrial DNA NADH dehydrogenase 1 (mtND1) gene showed that the E. granulosus strain from Estonia was identical to strain G10, recently characterized in reindeer and moose in Finland.
  Key words:  Canis lupus, Echinococcus granulosus, Estonia helminths, Trichinella.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Wolves (Canis lupus) have been present in Estonia since the last Ice Age, and in some periods they have been numerous (Lepiksaar, 1986; Lõugas and Maldre, 2000). During recent centuries, the wolf has been managed extensively and its numbers have fluctuated depending on hunting pressure and immigration (Valdmann et al., 2004a). Close association with the Russian wolf population has been a key factor for the abundance of the Estonia wolf population, no matter how extensive the hunting. According to 2005 monitoring data, there are 85 wolves distributed throughout Estonia. Hunting is currently limited by quota; 37 animals were shot in 2004.

Data on wolf helminths in Northern and Eastern Europe are relatively scarce. The helminth fauna of wolves has been described for the European part of Russia (Jushkov, 1995), Lithuania (Kazlauskas and Prusaite, 1976), Poland (Soltys, 1964), and Belorussia (Shimalov and Shimalov, 2000). Distribution of the tapeworm Echinococcus granulosus (Hirvelä-Koski et al., 2003) and nematodes of the genus Trichinella among wolves has been studied in Finland (Oivanen et al., 2002) and Estonia (Järvis et al., 2001; Miller, 2003). In addition, the infection of wolves with E. granulosus has been reported in adjacent countries: Russia (Jushkov, 1995) and Lithuania (Kazlauskas and Prusaite, 1976). However, the sylvatic cycle of E. granulosus has been described only in Finland, identifying the wolf as a definitive host and the reindeer (Rangifer tarandus) and moose (Alces alces) as an intermediate host (Hirvelä-Koski et al., 2003).

Tapeworms of the genus Echinococcus are important parasites of mammals and the genus includes four species: E. granulosus, E. multilocularis, E. oligarthrus, and E. vogeli. Echinococcus granulosus, which causes the life-threatening disease cystic echinococcosis, is of significant medical and public health concern. The wolf is considered the principal definitive host for E. granulosus among wild carnivorous animals in Northern latitudes of Eurasia; moose and reindeer serve as intermediate hosts. The general domestic life cycle of E. granulosus involves dogs as the definitive hosts and livestock as intermediate hosts (Eckert et al., 2001).

Echinococcus granulosus is characterized as the most diverse species in the genus. Ten different genotypes (G1–G10) have been identified and categorized according to host and geographic range (McManus, 2002; Lavikainen et al., 2003). At least seven strains have been found in humans (G1, G2, G5, G6, G7, G8, and G9) (Thompson and McManus, 2002). As genetic diversity of E. granulosus seems to reflect differences in infectivity for distinct hosts (McManus, 2002), and as several strains are dangerous to humans, it is of great importance to use genetic methods for correct species and strain identification. These findings may have considerable implications for public health.

The aim of the present study was to provide the first data on helminth fauna of wolves in Estonia and to characterize the E. granulosus specimens obtained from them.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 LITERATURE CITED
 
Twenty-six wolf carcasses were collected from nine of 15 Estonian counties during the hunting seasons in 2000/2001 and 2003/2004. Carcasses were sexed and aged into two classes (young [<2 yr old, body weight <40 kg] and adult [>2 yr old, weight, >40 kg]) according to Aul et al. (1957).

Material was kept frozen until examination. Fecal samples were examined for helminth eggs by the flotation method. Muscle samples were taken from tibialis anterior muscle and examined by the compression method for Trichinella larvae. The identification of Trichinella species was carried out in the Trichinella Reference Centre. The random amplified polymorphic DNA analysis (RAPD) was used following the protocol of Bandi et al. (1995). Trachea, lungs, heart, intestinal tract, liver, gall bladder, kidneys, and urinary bladder were separated and examined according to recognized helminthological methods (Howie, 2000).

Helminths were fixed in Barbagallo’s solution (Parre, 1985). Echinococcus specimens were preserved in 90% ethanol. All helminths were counted and identified. The identification of trematodes, nematodes, and cestodes was made according to Kozlov (1977). Cestodes of the genus Taenia and specimens of E. granulosus were determined according to Verster (1969) and Abuladze (1964), respectively. As no findings of mature E. granulosus have been documented in Estonia before, molecular genetic methods were used to confirm morphological identification. Specimens of parasites were deposited in the Zoological Museum of Tartu University, Tartu, Estonia, as Accession No. 1.

Two mature specimens of E. granulosus, obtained from a single wolf, were subjected to DNA extraction, PCR (polymerase chain reaction), PCR-RFLP (restriction fragment length polymorphism), and sequencing analysis. One mature E. multilocularis, obtained from the red fox (Vulpes vulpes) (Moks et al., 2005), was analyzed for comparison.

Total genomic DNA was extracted from E. granulosus with the use of a High Pure PCR Template Preparation Kit (Roche Diagnostics, Mannheim, Germany) following manufacturer’s protocol. Loci Eg9 and Eg16 were analyzed according to Gonzalez et al. (2002). The Eg9 locus was PCR amplified by using oligonucleotide primers PEg9F1 and PEg9R1, and the Eg16 locus with primers PEg16F1 and PEg16R1. PCR for Eg9 and Eg16 was performed in a total volume of 20 µl containing 20–80 ng of purified genomic DNA, 4 pmol of primers, 1X BD Advantage 2 PCR buffer (BD Biosciences, San Jose, California, USA), 1 U of BD Advantage 2 Polymerase Mix, 0.2 mM dNTP (Fermentas, Vilnius, Lithuania), and 1.5 mM MgCl2. PCR cycling parameters were: 1-min denaturing step at 95 C, followed by 37 cycles of 30 sec at 95 C, 30 sec at 60 C, 40 sec at 68 C, and at the end the final extension 68 C for 7 min. Then 7 µl of the Eg9-PCR product was restricted for 5 hr with 10 U of either Cfo I (Roche Diagnostics) or Rsa I (New England Biolabs, Beverly, Massachussettes, USA) in a total volume of 10 µl according to manufacturer’s protocol. The PCR and PCR-RFLP products were resolved by 2% agarose gel electrophoresis, visualized by ethidium bromide staining under UV light, and photographed.

A 529 bp fragment of the mitochondrial DNA NADH dehydrogenase 1 (mtND1) gene was amplified with primers NDfor1 5'AGATTCGTAAGGGGCCTAATA 3' and NDrev1 5'ACCACTAACTAATTCACTTTC 3' (Turcekova et al., 2003). Then 20–80 ng of purified genomic DNA and 4 pmol of primers were used for PCR. The PCR was performed in a total volume of 20 µl. Cycling parameters were 1-min denaturing step at 95 C, followed by 40 cycles of 30 sec at 95 C, 30 sec at 50 C, and 45 sec at 68 C, and at the end, 68 C for 7 min. Reactions were carried out in 1X BD Advantage 2 PCR buffer with 1U BD Advantage 2 Polymerase Mix, 0.2 mM dNTP, and 1.5 mM MgCl2. The PCR product was purified with shrimp alkaline phosphatase and exonuclease I treatment. One unit of each enzyme (USB, Cleveland, Ohio, USA) were added to 10 µl of PCR reaction and incubated 30 min at 37 C, followed by a 15-min inactivation phase at 80 C. DNA cycle sequencing was performed with DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences, Uppsala, Sweden). Thirty-three cycles (15 sec at 95 C, 15 sec at 50 C, and 60 sec at 60 C) were performed in a volume of 10 µl. Sequences were resolved on an ABI PRISM 377 automated DNA sequencer (Applied Biosystems, Foster City, California, USA). The mtND1 fragment was sequenced in both directions with 5 pmol of primers NDfor1 and NDrev1.

Consensus sequences were created with the program CONSED (Gordon et al., 1998), with sequence data of both DNA strands. Sequences were double-checked by eye and aligned with Clustal W (Thompson et al., 1994). Program BioEdit was used as a sequence editor (Hill, 1999). In addition to the two E. granulosus sequences obtained in this study, eight E. multilocularis (seven from GenBank and one from Moks et al., 2005), 24 E. granulosus mtND1 sequences and outgroup sequences of Taenia solium, E. vogeli, and E. oligarthrus were included from the GenBank. MODELTEST version 3.06 (Posada and Crandall, 1998) was used to establish the model of DNA substitution that best fitted the data. Phylogenetic analyses were conducted with the use of a maximum-likelihood (ML) algorithm. ML analysis was performed with PAUP 4.0g10 (Swofford, 1998). Robustness was assessed by 1,000 bootstrap replicates.

The binary coefficient of Sorensen (Krebs, 1999) was used to compare the similarity in helminth fauna of local wolves and Eurasian lynx (Lynx lynx). Lynx data were obtained from a previous study (Valdmann et al., 2004b).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 LITERATURE CITED
 
All animals were infected, and 13 species of helminths (one trematode, seven cestode, and five nematode species) were identified (Table 1Go). The most prevalent species were Alaria alata and Uncinaria stenocephala, which also showed the highest mean intensities, 303 and 11.6, respectively. The average number of gastrointestinal helminths per host was 325, ranging from 2 to 1,571. Both Trichinella nativa and T. britovi larvae were detected from muscle samples. Eggs of Capillaria spp. were found in three fecal samples, although no Capillaria worms were found at necropsy. Eggs of U. stenocephala and Toxocara canis were present in fecal samples. No differences in the intensity of infection were found among age and sex groups.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Prevalence and intensity of infection of helminths in Estonia wolves (n=26).

 
Echinococcus granulosus was identified in one wolf with the use of morphologic criteria as described by Abuladze (1964), and the identification was confirmed by genetic analysis with the use of total genomic DNA obtained from two specimens. Fragments of the Eg9 and Eg16 loci were successfully PCR-amplified, and sizes of the PCR products were similar to those obtained by Gonzalez et al. (2002) from E. granulosus (Fig. 1Go). When the Eg9 PCR product was cleaved with restriction enzymes (Fig. 1Go), Cfo I did not cut the Eg9 sequence for E. granulosus, but the Eg9 sequence for E. multilocularis was cut and gave exactly the same restriction pattern as described in Gonzalez et al. (2002). Restriction enzyme Rsa I had no recognition sequence within Eg9 locus for E. granulosus specimen 1, but for specimen 2, Rsa I gave a fragment that was slightly over 400 bp, demonstrating that the Eg9 sequence was somewhat different between the two E. granulosus specimens. The restriction enzyme Rsa I did not cut the E. multilocularis Eg9 sequence. Thus, PCR and PCR-RFLP confirmed that E. granulosus specimens were correctly identified using morphologic characters.


Figure 1
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1. Diagnostic PCR-RFLP analysis for Echinococcus granulosus (lanes 5–12, two specimens in parallel). E. multilocularis (lanes 1–4, one specimen) is a control. Lanes: (M) Gene Ruler 100 bp DNA ladder; (1) E. multilocularis (E.mu)-Eg9 PCR; (2) E.mu-Eg9 + CfoI; (3) E.mu-Eg9 + RsaI; (4) E.mu-Eg16; (C) PCR negative control; (5 and 6) E. granulosus (E.gr)-Eg9 PCR, specimens 1 and 2; (7, 8) E.gr-Eg9 + CfoI, specimens 1 and 2; (9, 10) E.gr-Eg9 + RsaI, specimens 1 and 2; (11, 12) E.gr-Eg16 PCR, specimens 1 and 2.

 
Both E. granulosus specimens gave identical sequences of 426 bp length when a fragment of the mtND1 gene was PCR-amplified and sequenced (sequence submitted to GenBank [AY842287]). When aligned with sequences from the Gen-Bank, the E. granulosus sequence from Estonia was found to be identical with AF525297 (genotype G10), a mtND1 sequence of E. granulosus obtained from reindeer and moose in Finland (Lavikainen et al., 2003). MODELTEST selected the TrN+I+G model of DNA substitutions that best fitted the data. On a ML phylogenetic tree, E. granulosus mtND1 sequence from Estonia clustered with other E. granulosus sequences and was distinguished clearly from sequences of all other species, including E. multilocularis (data not shown). Topology of the phylogenetic tree was essentially the same as described by Lavikainen et al. (2003). The most remarkable feature of the phylogram is that geographically distant genotypes G10 (from Finland and Estonia) and G8 (from the USA) group together; their closest neighbors are genotypes G6 and G7. Genotype G10 differs from G8 and G6 by 12 mutations and from G7 by 14 mutations. The more distant genotype G5 is separated from G10 by 28 mutations.

Sorensen’s binary coefficient of helminth fauna similarity between local wolves and lynx was 0.42.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
LITERATURE CITED
 
All helminth species of wolves found in Estonia during this study have been found in adjacent countries—Russia, Lithuania, and Poland (Soltys, 1964; Kazlauskas and Prusaite, 1976; Kozlov, 1977; Jushkov, 1995). The number and species composition of helminths of the wolf in Estonia and neighboring areas is comparable as well. Similarity in helminth fauna is due most likely to similarity in diet. If available, wolves tend to feed on medium size ungulates (Okarma, 1995), but they also feed on smaller prey, especially in summer. Hares, small rodents, raccoon dogs (Nyctereutes procyonoides), and beavers (Castor fiber) form a significant proportion of the wolf’s summer diet in Estonia (Valdmann et al., 1998).

The PCR-RFLP analysis of two specimens of E. granulosus (obtained from a single wolf) revealed different genotypes at the Eg9 locus (Fig. 1Go, lanes 10 and 11), implying that the wolf most likely acquired infection of E. granulosus from more than one source. The strain of E. granulosus from the wolf in Estonia carries an identical mtND1 sequence with the strain G10 identified from cervids (moose and reindeer) in Finland (Lavikainen et al., 2003). In addition to G10, another cervid strain, G8 from the United States (Minnesota and Alaska), has been obtained from moose, but also from humans (Bowles and McManus, 1993; McManus et al., 2002). Interestingly, E. granulosus genotype G8 from the USA (Minnesota) was the closest taxon to the genotype G10 from Finland and Estonia; and these haplotypes, together with genotypes G6 and G7, form a cluster on a phylogenetic tree (Lavikainen et al., 2003). Specificity of G8 and G10 to cervids is a likely explanation of their proximity on the phylogenetic tree. Because of the close phylogenetic position of mtDNA genotypes G6, G7, G8, and G10 and the fact that G6, G7, and G8 have been found also in humans, the G10 strain likely is a potential threat to the human population.

Two subspecies of E. granulosus, described by Sweatman and Williams (1963), occur in North America: E. granulosus borealis (North American origin) and E. granulosus canadensis (Scandinavian origin). Cervid genotype G10 is supposed to be related to E. g. canadensis (Lavikainen et al., 2003). Surprisingly, morphologic features (the number of segments and the length of the gravid proglottid) of E. granulosus G10 in Estonia were more similar to E. g. borealis. However, the incomplete set of morphologic characters (the wolf infected with E. granulosus was in poor post-mortem condition and all E. granulosus specimens were without hooks) and limited number of specimens of E. granulosus did not allow closer examination of subspecies status or analysis of the correlation between morphology and the mtDNA genotype. As there is large variation in morphological characters within the E. granulosus (Thompson and McManus, 2001), subspecies identification and correlation of phenotypes with genotypes requires an analysis of large number of specimens sampled all over the world.

The value of the calculated binary similarity coefficient of Sorensen (0.42) for wolf and lynx presumably reflects the presence of common prey species. Indeed, a high overlap of local wolf and lynx winter diet food niches (Pianka’s coefficient was 0.9, Valdmann et al., 2005) most certainly provides a good ground for wolves and lynx to have similar helminth faunas. On the other hand, one would expect to have higher overlap in helminths, as the food niche overlap is remarkable. Relatively modest overlap in helmith faunas can be explained by different susceptibility of hosts to certain helminth species; different summer diets of these predators may also impact their helminth faunas.

Populations of E. granulosus-infected wildlife can act as an important reservoir in promoting the transmission of the parasite to both domestic animals and humans. The general domestic life cycle of E. granulosus involves the dog as the definitive host and livestock as intermediate hosts (Eckert et al., 2002). Among domestic animals in Estonia, E. granulosus larvae were found only from pigs (Lesins, 1955). No infected dogs have been reported (Talvik, 1998; Jõgisalu, 2003). Considering the fact that cysts of E. granulosus have been found in moose in Estonia (I. Jõgisalu and T. Järvis, unpubl. data), it is conceivable that the wolf obtained the E. granulosus by consuming moose. Therefore, further studies are required to evaluate different cycles responsible for spreading echinococcosis in Estonia.


   ACKNOWLEDGMENTS
 
We thank Edoardo Pozio from Trichinella Reference Centre for help in molecular typing of Trichinella and Peep Männil from the Estonian Ministry of the Environment for helping to collect wolf samples. This work was supported by target financing 0181432 from Estonian Ministry of Education and Sciences. Experiments of this study comply with the current laws of Estonia.


   FOOTNOTES
 
4 Authors contributed equally to this work Back


   LITERATURE CITED
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
ABULADZE, K. I. 1964. Echinococcus granulosus (Batsch, 1786) Rudolphi 1801. In Common cestodology: Part 4. Taeniidae—tapeworms of animals and humans and causal agents of their illnesses. Nauka, Moscow, pp. 314–339. [In Russian.]

AUL, J., H. LING, AND K. PAAVER. 1957. Mammals of ESSR. Eesti Riiklik Kirjastus, Tallinn, 247 pp. [In Estonian.]

BANDI, C., G. LA ROSA, M. G. BARDIN, G. DAMIANI, S. COMINCINI, L. TASCIOTTI, AND E. POZIO. 1995. Random amplified polymorphic DNA fingerprints of the eight taxa of Trichinella and their comparison with allozyme analysis. Parasitology 110: 401–407.

BOWLES, J., AND D. P. MCMANUS. 1993. NADH dehydrogenase I gene sequences compared for species and strains of the genus Echinococcus. International Journal for Parasitology 23: 969–972.[Medline]

ECKERT, J., P. M. SCHANTZ, R. B. GASSER, P. R. TORGERSON, A. S. BESSONOV, S. O. MOVSESSIAN, A. THAKUR, F. GRIMM, AND M. A. NIKOGOSSIAN. 2001. Geographic distribution and prevalence. In WHO/OIE manual on echinococcosis in humans and animals: A public health problem of global concern, M. Gemmell, F. X. Meslin and Z. Pawlowski (eds.). World Organisation for Animal Health, Paris, pp. 100–142.

GONZALEZ, L. M., K. DANIEL-MWAMBETE, E. MONTERO., M. C. ROSENZVIT, D. P. MCMANUS, T. CARATE, AND C. CUESTA-BANDERA. 2002. Further molecular discrimination of Spanish strains of Echinococcus granulosus. Experimental Parasitology 102: 46–56.[Medline]

GORDON, D., C. ABAJIAN, AND P. GREEN. 1998. CONSED: A graphical tool for sequence finishing. Genome Research 8: 195–202.[Abstract/Free Full Text]

HILL, T. A. 1999. BIOEDIT: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid Symposium Series 41: 95–98.

HIRVELA-KOSKI, V., V. HAUKISALMI, S. S. KILPELA, M. NYLUND, AND P. KOSKI. 2003. Echinococcus granulosus in Finland. Veterinary Parasitology 111: 175–192.[Medline]

HOWIE, F. 2000. Necropsy and sampling techniques. In Disease of sheep, W. B. Martin and I. D. Aitken (eds.). Blackwell Science Ltd, Oxford, UK, pp. 495–496.

JARVIS, T., I. MILLER, AND E. POZIO. 2001. Epidemiological studies on animal and human trichinellosis in Estonia. Parasite 8: 86–87.

JOGISALU, I. 2003. Helminths of wolf (Canis lupus) and dog (Canis familiaris) in Estonia and comparison of their helmintofaunas. B.Sc. Thesis, University of Tartu, Tartu, 47 pp. [In Estonian with English summary.]

JUSHKOV, V. F. 1995. Canis lupus L.—wolf. In Fauna of European part of Russia. Helminths of mammals. Nauka, Sankt-Peterburg, pp. 114–120. [In Russian.]

KAZLAUSKAS, J., AND J. PRUSAITE. 1976. Helminths of the order Carnivora in Lithuania. Acta Parasitologica Lituanica 14: 33–41. [In Russian with English summary.]

KOZLOV, D. P. 1977. Key of helminths of carnivores. Nauka, Moscow, 245 pp. [In Russian.]

KREBS, C. J. 1999. Ecological methodology. Harper Collins, New York, 645 pp.

LAVIKAINEN, A., M. J. LEHTINEN, T. MERI, V. HIRVELA-KOSKI, AND S. MERI. 2003. Molecular genetic characterisation of the Fennoscandian cervid strain, a new genotype group (G10) of Echinococcus granulosus. Parasitology 127: 207–215.[Medline]

LEPIKSAAR, J. 1986. The holocene history of therio-fauna in Fennoscandia and the Baltic countries. Striae 24: 51–70.

LESINS, K. L. 1955. Analysis of helminth fauna and seasonal dynamics of helminthosis of farm animals in South-East of ESSR; Can. Dissertation. Tartu, 181 pp. [In Russian.]

LOUGAS, L., AND L. MALDRE. 2000. The history of theriofauna in the eastern Baltic region. Folia Theriologica Estonica 5: 86–100.

MCMANUS, D. 2002. The molecular epidemiology of Echinococcus granulosus and cystic hydatid disease. Transactions of the Royal Society of Tropical Medicine and Hygiene 96: 151–157.[Medline]

———, L. ZHANG, L. J. CASTRODALE, T. H. LE, M. PEARSON, AND D. BLAIR. 2002. Short report: Molecular genetic characterisation of an unusually severe case of hydatid disease in Alaska caused by the cervid strain of Echinococcus granulosus. American Journal of Tropical Medicine and Hygiene 67: 296–298.[Abstract]

MILLER, I. 2003. Trichinellosis in Estonia: Epidemiology, diagnosis and control. Ph.D. Thesis, Estonian Agricultural University, Tartu, 147 pp. [In Estonian with English summary.]

MOKS, E., U. SAARMA, AND H. VALDMANN. 2005. Echinococcus multilocularis in Estonia. Emerging Infectious Diseases 11: 1973–1974.[Medline]

OIVANEN, L., C. M. CAPEL, E. POZIO, G. LA ROSA, T. MIKKONEN, AND A. SUKURA. 2002. Associations between Trichinella species and host species in Finland. Journal of Parasitology 88: 84–88.[Medline]

OKARMA, H. 1995. The trophic ecology of wolves and their predatory role in ungulate communities of forest ecosystems in Europe. Acta Theriologica 40: 335–386.[Medline]

PARRE, J. 1985. Veterinary parasitology. Valgus, Tallinn, pp. 230–232. [In Estonian.]

POSADA, D., AND K. A. CRANDALL. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics 14: 817–818.[Abstract/Free Full Text]

SHIMALOV, V. V., AND V. T. SHIMALOV. 2000. Helminth fauna of the wolf (Canis lupus Linnaeus, 1758) in Belorussian Polesje. Parasitology Research 86: 163–164.[Medline]

SOLTYS, A. 1964. Helmintofauna wilkow. Wiadomosci Parazytologiczne 1: 59–64. [In Polish.]

SWEATMAN, G. K., AND R. J. WILLIAMS. 1963. Comperative studies on the biology and morphology of Echinococcus granulosus from domestic livestock, moose and reindeer. Parasitology 53: 339–390.[Medline]

SWOFFORD, D. L. 1998. PAUP*: Phylogenetic analysis using parsimony (*and other methods), Version 4.0g10. Sinauer Associates, Sunderland, Massachusetts,

TALVIK, H. 1998. Dog intestinal helminth parasites of urban and suburban area of Tartu. Eesti Loomaarstlik Ringvaade 2: 43–45. [In Estonian.]

THOMPSON, J. D., D. G. HIGGINS, AND T. J. GIBSON. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acid Research 22: 4673–4680.[Abstract/Free Full Text]

THOMPSON, R. C. A., AND D. P. MCMANUS. 2001. Aetiology: parasites and life-cycles. In WHO/OIE manual on echinococcosis in humans and animals: A public health problem of global concern, M. Gemmell, F. X. Meslin and Z. Pawlowski (eds.). World Organisation for Animal Health, Paris, pp. 1–16.

———, AND ———. 2002. Towards a taxonomic revision of the genus Echinococcus. Trends in Parasitology 18: 452–457.[Medline]

TURCEKOVA, L., V. SNABEL, S. D’AMELIO, M. BUSI, AND P. DUBINSKI. 2003. Morphological and genetic characterization of Echinococcus granulosus in the Slovak Republic. Acta Tropica 85: 223–229.[Medline]

VALDMANN, H., O. KOPPA, AND A. LOOGA. 1998. Diet and prey selectivity of wolf Canis lupus in middle- and south-eastern Estonia. Baltic Forestry 4: 42–45.

———, N. LAANETU, AND M. KORSTEN. 2004a. Group size changes and age/sexcomposition of harvested wolf (Canis lupus) in Estonia. Baltic Forestry 10: 83–86.

———, E. MOKS, AND H. TALVIK. 2004b. Helminth fauna of Eurasian lynx (Lynx lynx) in Estonia. Journal of Wildlife Diseases 40: 356–360.[Abstract/Free Full Text]

VALDMANN, H., Z. ANDERSONE, O. KOPPA, J. OZOLINS, AND G. BAGRADE. 2005. Winter diets of wolf (Canis lupus) and lynx (Lynx lynx) in Estonia and Latvia. Acta Theriologica 50: 521–527.

VERSTER, A. 1969. A taxonomic revision of the genus Taenia Linnaeus, 1758. Journal of Veterinary Research 36: 3–58.

Received for publication 22 March 2005.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moks, E.
Right arrow Articles by Valdmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moks, E.
Right arrow Articles by Valdmann, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS