| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Laboratorio de Diagnóstico e Investigaciones Bacteriológicas, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Calle 60 y 118, La Plata (1900), Buenos Aires, Argentina
2 Servicio Fisiopatogenia, Instituto Nacional de Enfermedades Infecciosas—ANLIS "Dr. Carlos G. Malbrán," Vélez Sarsfield 563, Buenos Aires, Argentina
3 Cátedra de Virología, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Calle 60 y 118, La Plata (1900), Buenos Aires, Argentina
4 Corresponding author (email: gleotta{at}fcv.unlp.edu.ar)
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Two potential reservoirs for P. multocida in waterfowl populations have been suggested: carrier birds and wetland sites. P. multocida occasionally has been isolated from healthy waterfowl (Vaught et al., 1967; Korschgen et al., 1978), and a recent study showed evidence that birds serve as a reservoir for avian cholera (Samuel et al., 2005).
The Hope Bay area, located on the tip of the Antarctic Peninsula, encompasses Base Antártica Esperanza, the northernmost continental Antarctic Station (63° 24'S, 56° 59'W). During spring and summer seasons, Adelie penguins (Pygoscelis adeliae), gentoo penguins (Pygoscelis papua), kelp gulls (Larus dominicanus), brown skuas (Stercorarius antarctica lonnbergi), south polar skuas (Stercorarius maccormicki), snowy sheathbills (Chionis albus), Antarctic terns (Sterna vittata), and Wilson’s storm petrels (Oceanites oceanicus) are breeding in Hope Bay; and six species—southern giant petrels (Macronectes giganteus), southern fulmars (Fulmarus glacialoides), cape petrels (Daption capense), snow petrels (Pagodroma nivea), black-bellied storm petrels (Fregetta tropica), and imperial shags (Phalacrocorax albiventer)—are visiting the area (Coria and Montalti, 1993). This study describes two outbreaks of avian cholera among wild birds in Hope Bay during the 1999–2000 and 2000–01 breeding seasons.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Hope Bay (63° 24'S, 56° 59'W) is separated from Bransfield, Joinville, and Dundee Islands by the Antarctic Strait. In general, the surroundings of the bay are covered by glaciers except for its southern face, which has an ice-free area of approximately 10 km2. The southwestern limit is the Deposit Glacier, and the northeastern margin is defined by a lighthouse. There are two coves in the abovementioned area, Hut Cove and Eagle Cove, separated by Seal Point. Hope Bay is characterized by the presence of 12 water bodies, mostly of glacial origin, the most important of which is Boeckella Lake (Fig. 1
).
|
), and active nests with at least one egg were marked. Population census was performed again by direct counting. Four transects between 1,000 and 3,000 m2 each were established, and breeding areas were surveyed during walks along these transects at seven-day intervals. Egg-laying and hatching data were recorded, and a population census of nonbreeding south polar skuas, brown skuas, and kelp gulls was performed by direct counting. In addition, walks through the four transects were carried out each day to record mortality, and six additional transects of 1,500 m2 were established through the Adelie penguin colony.
Sample collection and histopathology
Carcasses collected during the 1999–2000 breeding season were frozen and sent to Laboratorio de Diagnó stico e Investigaciones Bacteriológicas (LADIB; Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Argentina) for microbiological and pathological studies. Dead birds involved in the 2001 outbreak were collected and identified; they were necropsied at Hope Bay. Tissue samples were collected for microbiologic and histopathologic studies. Samples from trachea, lung, air sacs, pericardiac sacs, esophagus, stomach, intestine, heart, spleen, brain, liver, and kidney from carcasses taken during the two outbreaks were fixed in 10% buffered formalin for histopathologic studies. After embedding in paraffin, the samples were sectioned (3 µm) and stained with hematoxylin and eosin and periodic acid–Schiff (PAS).
Microbiological studies
Samples from lung, liver, spleen, and heart from carcasses collected during February 2000 were streaked on a blood agar plate (blood agar base, Difco, Becton Dickinson, Le Pont de Claix, France, with 5% defibrinated sheep blood) and incubated at 37 C for 48 hr. Samples from blood, liver, spleen, lung, air sacs, pericardiac sacs, and pharynx from all birds collected during 2001 were streaked on a blood agar plate, P. multocida selective agar PMSA (Moore et al., 1994) and hektoen enteric agar (Becton Dickinson); all plates were incubated at 37 C for 48 hr. For enterobacteria isolation, samples from cloaca swabs were streaked on hektoen enteric agar and incubated at 37 C for 48 hr. Bacterial colonies were stored at –20 C in brain-heart infusion (Difco Laboratories, Detroit, Michigan, USA) with 30% glycerol and sent to LADIB for identification. Samples from intestine, lung, and trachea were stored at –20 C for isolation and identification of Campylobacter spp. (Lior, 1984; Giacoboni et al., 1993) and Mycoplasma spp., as well as for detection of Chlamydophila psittaci (Leotta et al., 2003).
For fungus isolation, samples from trachea were streaked in duplicate on Sabouraud dextrose agar containing yeast extract and chloramphenicol (Difco, Becton Dickinson), and incubated at 28 and 37 C for 10 days. Thelebolus microsporus was identified as previously described (Leotta et al., 2002; de Hoog et al., 2005), and yeasts were identified by colony and cell morphology and by physiologic and biochemistry tests (Fell and Statzell-Tallman, 1998a, b).
Between January and February 2001, samples from pharyngeal swabs were collected from 90 healthy birds (30 Adelie penguins, 30 skuas, and 30 snowy sheathbills). These samples were streaked on PMSA and incubated at 37 C for 48 hr.
Between 19 January and 13 February 2001, 30 surface water samples from 10 lakes and ponds were collected. Water samples (250 ml) were collected at three different times from each of six lakes and four minor ponds. For each water sample, temperature and pH were measured in situ with a Hanna HI8314 (Hanna Instruments Argentina, Buenos Aires, Argentina). In addition, for each water sample, salinity was measured with a Hanna HI8033 (Hanna Instrument Argentina). One hundred microliters from each water sample were streaked on a blood agar plate and on PMSA in duplicate and incubated at 37 C for 48 hr.
Characterization of Pasteurella multocida isolates
Isolates were identified by morphologic and biochemistry characteristics (Fegan et al., 1995; Koneman et al., 1999). The capsular serotype was determined by a multiplex PCR assay (primers from Integrated DNA Technologies, Coralville, Iowa, USA, and reagents from Amersham Biosciences Corp., Piscataway, New Jersey, USA) (Townsend et al., 2001). Heat-stable antigens were serotyped by immunodiffusion according to the method of Heddleston et al. (1972) using antisera from the National Veterinary Services Laboratory (Ames, Iowa, USA). All isolates were serotyped by M. J. Wolcott at the USGS–National Wildlife Health Center, Madison, Wisconsin, USA.
The susceptibility of P. multocida strains to ampicillin, ceftiofur, cephalothin, enrofloxacin, florfenicol, gentamicin, streptomycin, tetracycline, and tiamulin was established. The minimum inhibitory concentration was determined by the broth microdilution test, and growth inhibition was evaluated according to the National Committee for Clinical Laboratory Standards for P. multocida (NCCLS M31-A2 and M7), with the exception of gentamicin (according to other non-Enterobacteriaceae values), ampicillin, tetracycline (according to Enterobacteriaceae values), tiamulin (according to Actinobacillus pleuropneumoniae values), and streptomycin (according to NORM/ NORM-VET 2002 for Escherichia coli values).
Molecular subtyping of Pasteurella multocida isolates
All isolates of P. multocida from both outbreaks were subtyped by enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) and pulsed-field gel electrophoresis (PFGE). For molecular comparison, six P. multocida strains were included: P. multocida multocida type A:1 (X-73), P. multocida gallicida type A:14 (NADC P-2225), P. multocida gallicida type A:1 from Australia poultry (donated by Dr. P. Blackall), P. multocida gallicida type A:1, and P. multocida septica type A:1 from Argentina poultry, and one strain isolated from a southern giant petrel during February 2000 in the South Shetland Islands at 200 km from Hope Bay (Leotta et al., 2003).
The ERIC-PCR was carried out essentially as described by Amonsin et al. (2002). One milliliter of P. multocida culture grown overnight in brain-heart infusion at 37 C (OD620:0.5 ml of culture) was used for genomic DNA extraction and purification by the WizardTM kit (Promega, Madison, Wisconsin, USA). Oligonucleotide primers ERIC1R (5' ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (5' AAGTAAGTGACTGGGGTGAGCG) were used to generate DNA fingerprints. The fragments obtained were separated by electrophoresis in 2% agarose gels containing ethidium bromide (2 µg/ml). Electrophoresis was carried out in a 1X tris-acetate-EDTA buffer for 3.5 hr at 80 V; 1 kb DNA Ladder (Promega) as a fragment size marker was used.
The PFGE was carried out essentially as described by Gunawardana et al. (2000). Briefly, the plugs of agarose containing DNA were digested with 40U of ApaI (Promega). Lambda Ladder PFGE Marker (New England BioLabs, Beverly, Massachusetts, USA) as fragment size marker was used. The fragments were separated in a 1.2% agarose gel (Pulsed Field Certified Agarose, BioRad, Hercules, California, USA) in 0.5X trisborate-EDTA buffer at 14 C in a contour CHEF-DR III system (BioRad). The run time was 22 hr, with a constant voltage of 170 V, using a linear pulse ramp of 1–30 sec. The staining was carried out with 0.5 µg/ml of aqueous ethidium bromide solution (BioRad). As a second enzyme, 40U of SmaI (Promega) was used for restriction with a linear pulse ramp of 0.5–40 sec for 22.5 hr (Pedersen et al., 2003). Salmonella Braenderup CDC H-9812 was included as fragment size marker to analyze the patterns generated with SmaI PFGE.
The gel images of PFGE and ERIC-PCR fingerprints obtained by Kodak Digital Science 1DTM were analyzed using BioNumerics version 3.5 (Applied Maths, Kortrijk, Belgium). The relationship among the patterns was estimated by the proportions of shared bands applying the Dice coefficient with a 1.5% band position tolerance, and a dendrogram based on the UPGMA method was generated.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
On 15 February 2000, 100 kelp gulls and 84 skuas were counted. Kelp gulls were breeding in the Scar Hills and lighthouse areas, and skuas were breeding between Boeckella Lake and Flora Mount; nonbreeder kelp gulls and skuas were grouped around three ponds (Fig. 1). During austral summer 2000–01, nine breeding bird species were recorded in Hope Bay: kelp gull, south polar skua, brown skua, snowy sheathbill, Wilson’s storm petrel, antarctic tern, gentoo penguin, and Adelie penguin. The distribution of these species is shown in Figure. 1. Population estimates from direct counts for kelp gulls, south polar skuas, brown skuas, and snowy sheathbills collected in the 2000–01 breeding season are shown in Tables 1 and 2. Antarctic tern and Wilson’s storm petrel colonies in Flora Mount were observed.
|
|
In February 2000 the mortality rate for nonbreeder kelp gulls was 2% (2/100), and for nonbreeder skuas 16% (13/84). They were found dead around ponds where nonbreeder flying birds were settled. Between 10 January and 7 February 2001, three nonbreeder kelp gulls, representing 2% of the population, were found dead. On 17 January nonbreeder skuas started to die, and 23 skua carcasses were collected until 20 February. Of these carcasses, 10 were south polar skuas, and 13 were brown skuas; the mortality for the south polar skua population was 47%, and for brown skuas it was 24% (Table 3). All birds affected by avian cholera were found around ponds.
|
Pathology
In the 1999–2000 breeding season, two kelp gulls and eight brown skuas were studied. At necropsy, no ectoparasites or skin lesions were seen. Fibrin deposits over coelomic serous membranes, liver capsule, and pericardium of two kelp gulls and seven brown skuas were seen. Autolytic changes and damage due to freezing severely hampered the histopathologic evaluation of the tissues. Severe congestion, edema, and fibrin in the pulmonary parenchyma of all birds were observed. Lesions observed in skuas and kelp gulls were compatible with subacute avian cholera.
During the 2000–01 breeding season, 71 birds were studied. Among them, four south polar skuas, two brown skuas, and 14 Adelie penguins were found dying. The skuas had polydipsia, tremors, and dyspnea. Stertors, nostrils and mouth filled with abundant secretions, inability to fly and uncoordination, general weakness, and loss of a fear response to approaching humans were also seen. Moreover, they had a body temperature above 43 C. The penguins were observed with nervous signs, tremors, incoordination, and opisthotonos.
Field necropsies of 23 skuas, three kelp gulls, and 45 Adelie penguins were performed. In all birds the conjunctiva was hyperemic. Ectoparasites were not seen. The stomach was empty, except for penguins, which contained a normal amount of krill. Typical lesions of avian cholera were observed; large quantities of viscous mucus in the pharynx and hemorrhagic serosal surfaces of the coelomic cavity organs and peritoneal lining were observed. Predominant lesions observed in kelp gulls, skuas, and Adelie penguins are shown in Table 3.
Lesions observed in kelp gulls were compatible with chronic avian cholera. In these birds the outstanding gross lesion was exudate and edema in the air spaces of head with hemorrhages and congestion in skeletal muscles surrounding the skull. In one carcass no lesions of avian cholera were observed.
In skuas the principal lesions were compatible with subacute avian cholera. Fibrinous exudate involving the liver capsule, mesentery, air sacs, and pericardium with petechial hemorrhage and heterophilic infiltration in areas of acute focal necrosis was observed. In addition, these birds had respiratory tract edema, congestion, and perivascular hemorrhage with heterophils, macrophages, and lymphocytes.
In Adelie penguins the lesions were compatible with acute avian cholera. The principal lesions were hepatomegaly with multiple small necrotic areas and splenomegaly with petechiae and ecchymoses. The livers had multiple foci of coagulative necrosis and heterophilic infiltration. Hyperemia in the meninges was the only abnormality observed in the nervous system.
Isolation results
Pasteurella multocida was isolated from the lung of two skuas during the 2000 outbreak and from 53 birds during the 2001 outbreak. The number of isolates for each species is shown in Table 3. The two P. multocida isolates from kelp gulls were recovered from the mouth. Isolates from south polar skuas and brown skuas were primarily from lung. For Adelie penguins, P. multocida 27 isolates were recovered from liver and one from lung.
All isolates were gram-negative rods and produced indole, reduced nitrate, and were oxidase and catalase positive. Hemolysis production, MacConkey growth, and urease activity were negative. The isolates fermented glucose, mannitol, arabinose, sorbitol, dulcitol, mannose, and sucrose but not lactose, trehalose, maltose, galactose, and xylose. These isolates were sensitive to ampicillin, ceftiofur, cephalothin, enrofloxacin, florfenicol, gentamicin, streptomycin, tetracycline, and tiamulin. All 55 isolates were characterized as P. multocida gallicida, capsular type A, and somatic serotype 1.
Samples from 90 healthy birds were negative for P. multocida. Pasteurella multocida gallicida serotype A 1 was recovered from one of three water samples. The temperature, pH, and salinity of this pond were 5 C, 7, and 8.73 g/l, respectively. The pond was being used by nonbreeding skuas and kelp gulls.
During the 2000 outbreak, Rhodotorula minuta was isolated from cloaca and lung samples of three skuas. Cryptococcus albidus were recovered from cloaca samples of two skuas, and Campylobacter lari biotype I from the intestinal content of two skuas and one kelp gull. During the 2001 outbreak, T. microsporus from the trachea of one skua and three kelp gulls was isolated. An E. coli characterized as enteropathogenic E. coli was recovered from the pharynx of two skuas. All samples from both outbreaks were negative for Salmonella spp., C. psittaci, and Mycoplasma spp.
Molecular subtyping of Pasteurella multocida isolates
Sixty-two isolates (56 from Hope Bay, one from a southern giant petrel, and five additional isolates) were included in this study. Using ERIC-PCR, five different patterns were detected, with 10–13 separated bands between 0.2 and 1.2 kb. The 56 isolates of P. multocida gallicida type A:1 recovered during the two avian cholera outbreaks in Hope Bay and the strain isolated from a southern giant petrel from the South Shetland Islands were identical using ERIC-PCR, and the pattern had 10 bands. The other P. multocida studied yielded four different patterns. Pasteurella multocida multocida type A:1 (NADC X-73) and P. multocida gallicida type A:14 (NADC P-2225) shared the same pattern. This pattern was closely related to the pattern from the Antarctic strains with 94.9% similarity and one band difference. Three different patterns were obtained with the P. multocida gallicida type A:1 strain from Australia and P. multocida septica type A:1 and P. multocida gallicida type A:1 strains from Argentina; patterns for these had 81.6%, 80.0%, and 73.9% similarity to Antarctic strains, respectively (Fig. 2).
|
). The results obtained by ApaI were confirmed by SmaI PFGE. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
There have been two documented events of bacterial diseases that resulted in mortality in Antarctic birds. The first occurrence of avian cholera was in brown skuas reported on Livingston Island in the Antarctic Peninsula region; P. multocida A:1 was isolated (Parmelee et al., 1979). The second event, in February 2000, occurred in the South Shetland Islands; P. multocida A:1 was isolated from a dead southern giant petrel (Leotta et al., 2003).
In the past two decades, three bird mortality events were reported in Hope Bay. In 1981 and 1990, 12 skuas and 38 brown skuas were found dead, respectively (Montalti et al., 1996). The third mortality event occurred in February 1997, including 16 brown skuas and seven south polar skuas (Leotta et al., 2002). Unfortunately, the cause for this mortality was not determined.
During the P. multocida outbreaks in the 1999–2000 and 2000–01 breeding seasons in Hope Bay, avian cholera was diagnosed as the primary cause of mortality among birds. In wild birds this disease is predominantly described as acute (Wobeser, 1997). However, in Hope Bay apparent differences in susceptibility were observed between affected species. The chronic form of avian cholera was observed in kelp gulls, the subacute form in skuas, and the acute form in Adelie penguins. Most of the mortality was associated with skuas, mainly the south polar skua; Adelie penguins were least affected. However, the potential impact of avian cholera on the Adelie penguin population could not be established because these birds started their migration in the first days of February.
The isolation of P. multocida gallicida type A:1 from carcasses reinforced the clinical diagnosis. In addition, all the Antarctic strains showed near-identical phenotypic and genotypic characteristics and were indistinguishable by ERIC-PCR and by ApaI and SmaI PFGE, confirming these outbreaks. According to Tenover’s definition (Tenover et al., 1995), both outbreaks were due to a unique clone. It is interesting that all isolates of P. multocida gallicida recovered from wild birds of Hope Bay and the isolate from a southern giant petrel found dead in February 2000 in the South Shetland Islands have an indistinguishable molecular pattern; it is probable they share a common origin. The southern giant petrel might have acquired the infection eating dead or dying animals in Hope Bay and then died in the South Shetland Islands, as these birds are able to fly more than 400 km per day (Marchant and Higgins, 1993). Unfortunately, it was not possible to compare the isolates from Hope Bay with the former isolates from Livingston Island (Parmelee et al., 1979).
The unique molecular patterns obtained by ApaI and SmaI PFGE and ERIC-PCR with P. multocida gallicida A:1 strains from Antarctica were different from the patterns obtained with the five P. multocida gallicida A:1 strains of different origin, in spite of belonging to the same subspecies and serotype. However, it may be informative to compare the Hope Bay isolates with P. multocida strains isolated from other outbreaks involving wild birds and to utilize newer and more advanced molecular epidemiological techniques, such as multilocus sequence typing or multilocus variable-number tandem repeat analysis. The fact that all isolates were indistinguishable irrespective of bird species and the year of isolation could indicate a remarkable genetic stability and persistence of this strain. A similar situation was described in Denmark, where P. multocida strains recovered from wild birds in 1996 and 2003 were indistinguishable based on the same molecular techniques use in this study (Pedersen et al., 2003).
In contrast to other avian cholera outbreaks in wildfowl populations (Botzler, 1991), it is difficult to ascertain the possible origin of avian cholera in Hope Bay because of geographic isolation and the absence of domestic animals or invertebrate vectors. In addition, P. multocida has never been reported from Antarctic marine mammals. The extreme climatic conditions do not enhance environmental survival of P. multocida, and the failure to isolate P. multocida from healthy birds does not provide evidence for the presence of carriers.
Kelp gulls appeared to be more resistant to the disease. During the 1999–2000 breeding season, kelp gulls had lesions compatible with subacute avian cholera; in the 2000–01 breeding season lesions were compatible with chronic avian cholera. One possible hypothesis to explain both outbreaks is that nonbreeder kelp gulls carried P. multocida gallicida to Hope Bay. It is possible that the kelp gulls acquired the infection during the 1999–2000 breeding season and maintained the infection either in individual birds or in the population through bird-to-bird transmission according to Wobeser’s hypothesis (1992). One hundred and seven nonbreeder kelp gulls arrived 15 days before the onset of the 2001 outbreak, and they may have served as carriers (Rosen and Bischoff, 1950; Korschgen et al., 1978; Titche, 1979).
Once P. multocida was introduced to Hope Bay, we believe that contaminated water provided the primary means for spread to skuas and penguins. Although some water bodies in Hope Bay can be considered typical lakes, since they do not freeze to the bottom and are generally free of ice in summer, some shallow water bodies have permanent ice cover all year (Izaguirre et al., 1998). During the 2001 outbreak, P. multocida gallicida also was recovered from the water of a pond that both nonbreeding skuas and Adelie penguins drink from. This pond had the optimal physical and chemical conditions as well as pH, temperature, and salinity for P. multocida survival (Bredy and Botzler, 1989). In addition, only birds around these ponds were affected.
Other microoorganisms including R. minuta, C. albidus, T. microsporus, C. lari biotype I, and EPEC were isolated from some birds with avian cholera. As these microorganisms do not cause lesions similar to those of avian cholera, and they have never been reported as pathogens for wild birds, we consider that these birds could be asymptomatic carriers of these organisms in the Antarctic ecosystem.
We believe that avian cholera is not endemic in Antarctic and that P. multocida is introduced by migratory birds. All environmental isolates were restricted to one pool where the birds were settled, and to date the existence of an environmental reservoir has not been demonstrated. Currently it is not possible to take measures to resolve outbreaks by avian cholera in Antarctica because of international legislation (Antarctic Treaty). However, it is possible to prevent the introduction of microorganisms potentially affecting Antarctic birds populations as a consequence of human presence in Antarctica. To achieve this, we must know what diseases are present and understand their epidemiology in Antarctic wildlife.
|
ACKNOWLEDGMENTS |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
BOTZLER, R. G. 1991. Epizootiology of avian cholera in wildfowl. Journal of Wildlife Diseases 27: 367–395.[Abstract]
BREDY, J. P., AND R. G. BOTZLER. 1989. The effects of six environmental variables on Pasteurella multocida populations in water. Journal of Wildlife Diseases 25: 232–239.[Abstract]
CORIA, N. R., AND D. MONTALTI. 1993. Flying birds at Esperanza Bay, Antarctica. Polish Polar Research 14: 433–439.
DE HOOG, G. S., E. GOTTLICH, G. PLATAS, O. GENILLOUD, G. LEOTTA, AND J. V. BRUMMELEN. 2005. Evolution, taxonomy and ecology of the genus Thelebolus in Antarctica. Studies in Mycology 51: 33–76.
DE LISLE, G. W., W. L. STANISLAWEK, AND P. J. MOORS. 1990. Pasteurella multocida infections in Rockhopper penguins (Eudyptes chrysocome) from Campbell Island, New Zealand. Journal of Wildlife Diseases 26: 283–285.[Abstract]
FEGAN, N., P. J. BLACKALL, AND J. L. PAHOFF. 1995.Phenotypic characterization of Pasteurella multocida isolates from Australian poultry. Veterinary Microbiology 47: 281–286.[Medline]
FELL, J. W., AND A. STATZELL-TALLMAN. 1998a. Cryptococcus Vuillemin. In The yeasts: A taxonomic study, 4th Edition, C. P. Kurtzman and J. W. Fell (eds.). Elsevier Science B.V., Amsterdam, The Netherlands, pp. 742–767.
———, AND———. 1998b. Rhodotorula F. C. Harrison. In The yeasts: A taxonomic study, 4th Edition, C. P. Kurtzman and J. W. Fell (eds.). Elsevier Science B.V., Amsterdam, The Netherlands, pp. 800–827.
GIACOBONI, G., K. ITOH, E. TAKAHASHI, AND T. MITSUOKA. 1993. Comparison of fecal Campylobacter in calves and cattle of different ages and areas in Japan. Journal of Veterinary Science 55: 555–559.
GUNAWARDANA, G. A., K. M. TOWNSEND, AND A. J. FROST. 2000. Molecular characterisation of avian Pasteurella multocida isolates from Australia and Vietnam by REP-PCR and PFGE. Veterinary Microbiology 72: 97–109.[Medline]
HEDDLESTON, K. L., J. E. GALLAGHER, AND P. A. REBERS. 1972. Fowl cholera: Gel diffusion precipitin test for serotyping Pasteurella multocida from avian species. Avian Diseases 16: 925–936.[Medline]
IZAGUIRRE, I., A. VINOCUR, G. MATALONI, AND M. POSE. 1998. Phytoplankton communities in relation to trophic status in lakes from Hope Bay (Antarctic Peninsula). Hydrobiologia 369/370: 73–87.
KASCHULA, V. R., AND D. E. TRUTER. 1951. Fowl cholera in sea gulls on Dassen Island. Journal of the South African Veterinary Medical Association 22: 191–192.
KERRY, K., M. RIDDLE, AND J. CLARKE. 1999. Diseases of Antarctic wildlife. A report for SCAR and COMNAP. Australian Antarctic Division, Channel Highway, Kingston, Australia.
KONEMAN, E. W., S. D. ALLEN, W. M. JANDA, P. C. SCHRECKENBERG, AND W. C. WINN, JR. 1999. Enterobateriaceae. In Diagnóstico microbiológico, 5th Edition, E. W. Koneman (ed.). Springer, Editorial Médica Panamericana, Buenos Aires, pp. 388–461.
KORSCHGEN, C. E., H. C. GIBBS, AND H. L. MENDALL. 1978. Avian cholera in eiderducks in Maine. Journal of Wildlife Diseases 14: 254–258.[Abstract]
LEOTTA, G. A., J. PARE, L. SIGLER, D. MONTALTI, G. B. VIGO, M. PETRUCCELLI, AND E. H. REINOSO. 2002. Thelebolus microsporus mycelial mats in the trachea of wild brown skua (Catharacta antarctica lonnbergi) and south polar skua (C. maccormicki) carcasses. Journal of Wildlife Diseases 38: 443–447.[Abstract]
———, M. RIVAS, I. CHINEN, G. B. VIGO, F. A. MOREDO, N. CORIA, AND M. J. WOLCOTT. 2003. Avian cholera in a southern giant petrel (macronectes giganteus) from Antarctica. Journal of Wildlife Diseases 39: 732–735.[Abstract]
LIOR, H. 1984. New, extended biotyping scheme for campylobacter jejuni, Campylobacter coli and Campylobacter laridis. Journal of Clinical Microbiology 20: 636–640.
MARCHANT, S. and P. J. HIGGINS (eds.). 1993. Handbook of Australian, New Zealand and Antarctic Birds, Vol. 1. Oxford University Press, Melbourne, Australia, pp. 356–369.
MONTALTI, D., N. R. CORIA, AND A. CURTOSI. 1996. Unusual deaths of subantarctic skuas Catharacta antarctica at Hope Bay, Antarctica. Marine Ornithology 24: 39–40.
MOORE, M.K.,L.CICNJAK-CHUBBS,AND R.J.GATES.1994. A new selective enrichment procedure for isolating Pasteurella multocida from avian and environmental samples. Avian Diseases 38: 317–324.[Medline]
MYRCHA, A., A. TATUR, AND R. DEL VALLE. 1987. Numbers of Adelie penguin breeding at Hope Bay and Seymour Island rookeries (West Antarctica) in 1985. Polish Polar Research 8: 411–422.
NAKAMINE, M., M. OHSHIRO, Y. AMEKU, K. OHSHIRO, T. KERUMA, T. SAWADA, AND T. EZAKI. 1992. The first outbreak of fowl cholera in Muscovy ducks (Cairina moschata) in Japan. Journal of Veterinary Medical Science 54: 1225–1227.
NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS. 2002. Performance standard for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard 2nd Edition, M 31-A2. NCCLS, Wayne, Pennsylvania.
NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard 6th Edition, col 23 M 7-A6. NCCLS, Wayne, Pennsylvania.
NORM/NORM-VET. 2002. Consumption of antimicrobial agents and occurrence of antimicrobial resistance in Norway. Tromsø/Oslo 2003.
PARMELEE, D. F., S. J. MAXON, AND N. P. BERNSTEIN. 1979. Fowl cholera outbreak among Brown Skuas at Palmer Station. Antarctic Journal of the United States 14: 168–169.
PEDERSEN, K., H. H. DIETZ, J. C. JORGENSEN, T. K. CHRISTENSEN, T. BREGNBALLE, AND T. H. ANDERSEN. 2003. Pasteurella multocida from outbreaks of avian cholera in wild and captive birds in Denmark. Journal of Wildlife Diseases 39: 808–816.[Abstract]
ROSEN, M. N., AND A. I. BISCHOFF. 1950. The epidemiology of fowl cholera as it occurs in the wild. Transactions of the North American Wildlife Conference 15: 147–154.
SAMUEL, M. D., D. R. GOLDBERG, D. J. SHADDUCK, J. I. PRICE, AND E. G. COOCH. 1997. Pasteurella multocida serotype 1 isolated from a lesser snow goose: evidence of a carrier state. Journal of Wildlife Diseases 33: 332–335.[Abstract]
———, D. J. SHADDUCK, D. R. GOLDBERG, AND W. P. JOHNSON. 2005. Avian cholera in waterfowl: The role of lesser snow and Ross’s geese as disease carriers in the playa lakes region. Journal of Wildlife Diseases 41: 48–57.
SIMENSEN, E., AND L. D. OLSON. 1980. Aerosol transmission of Pasteurella multocida in turkeys. Avian Diseases 24: 1007–1010.[Medline]
TENOVER, F. C., R. D. ARBEIT, R. V. GOERING, P. A. MICKELSEN, B. E. MURRAY, D. H. PERSING, AND B. SWAMINATHAN. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. Journal Clinical Microbiology 33: 2233–2239.
TITCHE, A. 1979. Avian cholera in California. Wildlife Management Branch Administrative Report 79–2. California Department of Fish and Game, Sacramento, California, 49 pp.
TOWNSEND, K. M., J. D. BOYCE, J. Y. CHUNG, A. J. FROST, AND B. ADLER. 2001. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. Journal of Clinical Microbiology 39: 924–929.
VAUGHT, R. W., H. C. MCDOUGLE, AND H. H. BURGESS. 1967. Fowl cholera in waterfowl at Squaw Creek National Wildlife Refuge, Missouri. Journal of Wildlife Management 31: 248–253.
WOBESER, G. 1992. Avian cholera and waterfowl biology. Journal of Wildlife Diseases 28: 674–682.[Medline]
———. 1997. Diseases of waterfowl, 2nd Edition. Plenum Press, New York, New York, 324 pp.
———, D. B. HUNTER, B. WRIGHT, D. J. NIEMAN, AND R. ISBISTER. 1979. Avian cholera in waterfowl in Saskatchewan, spring 1977. Journal of Wildlife Diseases 15: 19–24.[Abstract]
Received for publication 10 January 2005.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
